                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -9.91 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gagtattattgaagtgccccttggagcttaagtgccgaattaagtaggtgtttatgggaactcccattatagagttagggtatgaatgtacctaaataga
gatggatattatatatctaatcagagtggaaccgtggaagtatagtcttctgcctctgtaatttacagaggtagagggctttttttattatattttgctg
gccagcatataaaaataaaattatactttgtaagcttggcttttaatataaaagcttagcaatattaaataaaaagtaattttataggaggaaatttttt
ATG

    CPE0947 Gene: CPE0947     GI: 18309929     BI number: CPE0947     GOG: COG1823     Description: probable transmembrane symporte   a t  t ta        ta at       a  g ta       t  t at        gc         t gc        at       a  t gt        at        at ta        gc        ta a  a       gt        gc g  |       tg        ta at        gc        cg gc       c  |       ta a  a      c  |       cg t  g      a  |       cg a  a      a  |       gt a  g      g  |       ta a  t      g  |       cg t  |      t  |       ta cg        gc        tg cg        at        cg a  a       gc        tg ta        at        gc gc        cg        at                         ttttttattatattttgctggccagcatataaaaataaaattatactttgtaagcttggcttttaatataaaagcttagcaatattaaataaaaagtaattttataggaggaaattttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1823 Predicted Na+/dicarboxylate symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................