                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:90 nt.    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.80 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=45 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=78 nt.     Delta G= -9.41 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-tataat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaaacgtaaattaaactactaagtataatatatgcttaaaaatttttattaagaactttagaagtgattttaagttaaataaaagattataaagtaat
tgatgttaagtaaaaatattaaggtgagttaaattattatgtagttttgctcaccttttttagtgtataatacttatatattttttaaaattaaattatt
aaaagtagaatttaatttcagttaatcataaagaataagatatgaatttttggagatattttcaaaataaaatttggaggcaacaaATG

    CPE0953 Gene: CPE0953     GI: 18309935     BI number: CPE0953     GOG: COG2081     Description: conserved hypothetical protei   t t  a g  a a  a at ta ta ta ta a  g g  | ta gt at a  a g  | at ta ta ta cg at         a a  a      a  a g  a      a  a at       t  t at       g  a tg        at         a ta        at       t  t at        ta        tg tg        ta        at t  |      g  g       ta t  |       tg        tg t  |       at        at t  |      g  g       at a  |       ta        at a  |       tg       t  t a  |       at        tg at        at        gc at        ta        at ta       g  a       gc ta       a  a       ta cg        at        gc gt        at        gc ta        ta        at                         tttttagtgtataatacttatatattttttaaaattaaattattaaaagtagaatttaatttcagttaatcataaagaataagatatgaatttttggagatattttcaaaataaaatttggaggcaacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2081 Predicted flavoproteins ... can be seen here     ..................................................................................................................