Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:110 nt.    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.90 kcal/mol
Antiterminator:    Distance from promoter:88 nt. Size=35 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:    Distance from promoter:53 nt.    Size=55 nt.     Delta G= -6.41 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-tagagt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtttccagaaataatcttaggttagagtaggggaatgcgggtatgcccgttatagcagagtggtatatttgtacctaaagagattttgtagtttaact
tagcttactacttaaaatcagagtggaaccgtggaattttacttctgcctctgtatagggggtagaagtttttttatttataaataattctttacatgaa
agtattaaataaaaaggggggataaattGTG

    CPE0967


Gene: CPE0967     GI: 18309949     BI number: CPE0967     GOG: COG1301     Description: probable glutamate/ aspartate transporte


  c
a  t
t  t
c  a
a  a
t  a
t  a
c  t
g  c
a  a       at
 tg       a  t
 ta        gt
 cg        gt
 at        ta         a
a  g       gc       t  t
 tg       c  |      g  a
 ta       c  |       tg
 ta        at        cg
 gc        at        tg
a  c       gc        cg
t  g       gt        cg
 gt        tg        gt
 tg       |  c       ta
 tg        gc        cg
 ta        at        ta
 ta        gc        ta
 at        at        cg
 gt        cg        at
                        ttttttatttataaataattctttacatgaaagtattaaataaaaaggggggataaattGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1301 Na+/H+-dicarboxylate symporters ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here
    ..................................................................................................................