                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:85 nt. Size=64 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:    Distance from promoter:41 nt.    Size=53 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAA-TAGAAT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGAATGAAACTTTAGATTCTGTAGAATCTGAAAAGGAAATAAATATGTTTAAGCAA
GTGTCTAATTTGAAATTTTAAtaatttatatttaatttaaaataagtacatataaattagaatttgtcactataaaacatatcta
tataaatattataattgttttaggctctgttttaaggaaatcctaacttttaaaacagagcttattttaaaaagatttagataaagggggagaggtttaa
ttaatttattaattaagctaataattatgagaaatttaaaggttATG

    CPE1055 Gene: CPE1055     GI: 18310037     BI number: CPE1055     GOG: COG3568     Description: hypothetical protei             a           a  t           a  a           t  t            at            ta            at   a        ta a  a      c  a at       t  t ta       a  | ta       t  | tg        at at        cg        aa a  a       at       a  t t  c       at        gc t  |       at        gc ta        at        at at        ta       |  a ta       a  |      |  a at       t  |      |  c ta       c  |      |  t ta       a  |      |  t ta        cg       |  t at        tg        at at        gc        ta ta       |  t       ta A  |      t  c       ta A  |      t  t       ta T  |       tg        gc Tg        at        ta Ta        at        cg Ta        gt        ta At        at        cg At        ta        gc At        ta        gt                         tattttaaaaagatttagataaagggggagaggtttaattaatttattaattaagctaataattatgagaaatttaaaggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3568 Metal-dependent hydrolase ... can be seen here     ..................................................................................................................