                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GATATT. It has a score value of 64.93 and is shown in blue

TTGATAAAGCAAATGTAAAATATAGATATTTAGGAAGCGATAGAGATAATTTATTAAT
ATCATTTAAGCCAGAAGATGTTTAAaataaataaaccccatagtattatctatggggtttattttaagagaaagtttataat
agttgacaatttttatttagtatagtatattttgaatatcaaaatatttggtttgatattcaaaatatttgaattttatatctaatgattttgaagtaag
ggagcgattttaggATG

    CPE1067 --- fabH Gene: CPE1067     GI: 18310049     BI number: CPE1067     GOG: COG1846     Description: probable transcriptional regulator Gene: fabH     GI: 18310050     BI number: CPE1068     GOG: COG0332     Description: 3-oxoacyl-[acyl-carrier-protein] synthase II           tt          a  a          t  t           gc           at           ta           at           cg           cg           cg           cg           at           at             tattttaagagaaagtttataatagttgacaatttttatttagtatagtatattttgaatatcaaaatatttggtttgatattcaaaatatttgaattttatatctaatgattttgaagtaagggagcgattttaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here [I] COG0332 3-oxoacyl-[acyl-carrier-protein] synthase III ... can be seen here     ..................................................................................................................