                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=60 nt.     Delta G= -3.61 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggta-taattt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggtataaattagatatatggtaatttatataattatactataacaaaaatgccaataaacatgaattgaggccaataaataatattgatgaaaaacca
ataaataattaaatttatagagttataaaacacttcttgttaattagttttttgctaattaataggaggtgttttttattATG

    CPE1095 Gene: CPE1095     GI: 18310077     BI number: CPE1095     GOG: COG4974     Description: probable integrase/recombinas ta a  a ta ta gc a  a gc at t  t a  c t  t t  t t  g a  | at at ta ta         t at       t  t at       t  t ta        tg a  |       gc a  |       at a  |       ta t  |       ta a  |       at a  |       at c  |       ta cg        ta at        gt at        ta at        tg at        cg at        ta             ggtgttttttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG4974 Site-specific recombinase XerD ... can be seen here     ..................................................................................................................