                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:41 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.50 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=17 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=30 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ataaat-gatact. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ataaattcctcattcttattagtgatacttattagagctgcacacatcataaagcaactctataccaattagagattactattaatttagtagtcttttt
tttattacaaaaatattatacgaaggtggtatgtaaaaATG

    CPE1109 Gene: CPE1109     GI: 18310091     BI number: CPE1109     GOG: -------     Description: hypothetical protei tc a  a                 aa c  t                t  t a  a                t  t c  a                 at a  a                 ta cg         c        cg gc       c  a       at ta       a  a       ta c  a      t  t       tg gc        at        at at        ta        gc gc        cg        at at        ta        gt ta        cg        at                         tttttattacaaaaatattatacgaaggtggtatgtaaaaATG     ..................................................................................................................