                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACAAGAAGTTGCTTATTATAAGCAATTTGTTAGTGTTTTCTATGATATAAAAACAGA
TATAGAAGAATGGGAGTGGCTTAGATAGacactctttttttatacccttttttcttaagaattaaggctagtagataat
agttactctttataattaaatatcaaatttagtaatcctttagctagtatgcgtacgaccaagcaagctaagaaagttagatcataggtgggtttattac
acagttaagatgttctgtgttatcaaaaacatcaaaaatttattataaaggggatattaaaaaATG

    CPE1110 --- CPE1111 --- CPE1112 --- CPE1113 --- CPE1114 --- CPE1115 Gene: CPE1110     GI: 18310092     BI number: CPE1110     GOG: COG3617     Description: phage-related conserved hypothetical protein Gene: CPE1111     GI: 18310093     BI number: CPE1111     GOG: -------     Description: hypothetical protein Gene: CPE1112     GI: 18310094     BI number: CPE1112     GOG: -------     Description: hypothetical protein Gene: CPE1113     GI: 18310095     BI number: CPE1113     GOG: -------     Description: hypothetical protein Gene: CPE1114     GI: 18310096     BI number: CPE1114     GOG: -------     Description: hypothetical protein Gene: CPE1115     GI: 18310097     BI number: CPE1115     GOG: -------     Description: hypothetical protei            AC           A  A   a       A  G a  a      A  A a  A       AT aT        TA tG        AT tG        TA aT       |  G tG       |  A aT       |  A gT       A  G        G g  T      G  A      A  A g  T       TA       T  T gC        AT        TA aT        TG        CG a  |       CG       G  a a  |       TG        Gc tA        TA        Ta aT        TG        Gc tG       T  T       At tA       G  G       Gc aT        TG        Gt tA        GC        Gt                         tttttatacccttttttcttaagaattaaggctagtagataatagttactctttataattaaatatcaaatttagtaatcctttagctagtatgcgtacgaccaagcaagctaagaaagttagatcataggtgggtttattacacagttaagatgttctgtgttatcaaaaacatcaaaaatttattataaaggggatattaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG3617 Prophage antirepressor ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.80 kcal/mol Antiterminator: Size=45 nt.     Delta G= -3.60 kcal/mol Anti-antiterminator:   Size=41 nt.     Delta G= -8.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AACAAGAAGTTGCTTATTATAAGCAATTTGTTAGTGTTTTCTATGATATAAAAACAGA TATAGAAGAATGGGAGTGGCTTAGATAGacactctttttttatacccttttttcttaagaattaaggctagtagataat agttactctttataattaaatatcaaatttagtaatcctttagctagtatgcgtacgaccaagcaagctaagaaagttagatcataggtgggtttattac acagttaagatgttctgtgttatcaaaaacatcaaaaatttattataaaggggatattaaaaaATG     CPE1110 --- CPE1111 --- CPE1112 --- CPE1113 --- CPE1114 --- CPE1115 Gene: CPE1110     GI: 18310092     BI number: CPE1110     GOG: COG3617     Description: phage-related conserved hypothetical protein Gene: CPE1111     GI: 18310093     BI number: CPE1111     GOG: -------     Description: hypothetical protein Gene: CPE1112     GI: 18310094     BI number: CPE1112     GOG: -------     Description: hypothetical protein Gene: CPE1113     GI: 18310095     BI number: CPE1113     GOG: -------     Description: hypothetical protein Gene: CPE1114     GI: 18310096     BI number: CPE1114     GOG: -------     Description: hypothetical protein Gene: CPE1115     GI: 18310097     BI number: CPE1115     GOG: -------     Description: hypothetical protei            AC           A  A   T       A  G A  A      A  A T  A       AT AA        TA GA        AT TA        TA A       |  G T       |  A C       |  A T       A  G        G T        G  A      A  A T         TA       T  T T        AT        TA G        TG        CG T  |       CG       G  a G  |       TG        Gc G        TA        Ta T        TG        Gc A       T  T       At a       G  G       Gc a        TG        Gt a        GC        Gt                         tttttatacccttttttcttaagaattaaggctagtagataatagttactctttataattaaatatcaaatttagtaatcctttagctagtatgcgtacgaccaagcaagctaagaaagttagatcataggtgggtttattacacagttaagatgttctgtgttatcaaaaacatcaaaaatttattataaaggggatattaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG3617 Prophage antirepressor ... can be seen here     ..................................................................................................................