                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.70 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=49 nt.     Delta G= -6.76 kcal/mol
Anti-antiterminator:    Distance from promoter:28 nt.    Size=51 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCTAG-TATAAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTAGTTCTCCAGTAGGAGGATATAATACAACACCTTCTATATCTTACATAGGAACT
AATGGTTTACCAACAGGTAGAGTTGTAACTGAAAATGGTGGATATGGAGCAAGTCCAT
ATTAGagagtagattaatttctactcttttttattacaagaaaggagaatattATG

    CPE1133 --- CPE1134 --- CPE1135 Gene: CPE1133     GI: 18310115     BI number: CPE1133     GOG: COG2333,COG5263     Description: probable choline binding protein Gene: CPE1134     GI: 18310116     BI number: CPE1134     GOG: COG3210     Description: hypothetical protein Gene: CPE1135     GI: 18310117     BI number: CPE1135     GOG: -------     Description: hypothetical protei GT         A A  T      C  A G  G      G  G A  T       AT T  A       GC G  A       GC GC        TA AT        AT CG        TA |  A       AT |  A       GT |  A      G  A A  A      T  G AT       G  a CG       G  g       aa CG       T  a      t  t AT       A  g      t  t TG       A  |       at TG       A  |       gc TA       A  |       at GT        Gt        ta G  A       Ta        gc T  T       Cg        at A  G      |  a       gc A  G       At        at TA        At        Gt CG        Ta        At                         tttattacaagaaaggagaatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2333 Predicted hydrolase (metallo-beta-lactamase superfamily) ... can be seen here [R] COG5263 FOG: Glucan-binding domain (YG repeat) ... can be seen here [U] COG3210 Large exoproteins involved in heme utilization or adhesion ... can be seen here     ..................................................................................................................