                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:19 nt.    Distance to gene:51 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=18 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAGA-TAGTAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAGATTAAAAACTTGTGTGATAGTATAAAGGGACTTACAACAGCCGTTAAAATGGG
GCTTATGCTTCATTAAtaacaacttttgtaggtttctttttttatgcatacaaatcatttatttaagtaggaggtagagacATG

    CPE1137 --- CPE1138 Gene: CPE1137     GI: 18310119     BI number: CPE1137     GOG: -------     Description: hypothetical protein Gene: CPE1138     GI: 18310120     BI number: CPE1138     GOG: -------     Description: conserved hypothetical protei            TA           T  T            CG            GC            GT            GT            GC AA        TA A  A       AT T  T       AT T  G      |  A G  G      A  A CG        At CG        Ta GC        Ta AT        Gc             aacttttgtaggtttctttttttatgcatacaaatcatttatttaagtaggaggtagagacATG     ..................................................................................................................