                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=61 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAAAGGAAAGAATTCCTGTAACAATATTTTTAGTAAATGGGGTTCAATTAAAGGGT
ATCGTTAAAGGGTTCGATAGCTTTACAGTAGTTTTAGATAGTGATGGAAAGCAACAAT
TAGTTTATAAACATGCTATAAGCACAGTATCACCAGCTAAACCTATTTTATTTAATAA
TGCGCAAGTTTTTGATAATTAAatatagaaaagaaaaataggtaaaccctagatggtttgcctattttttttctatatgataag
atttataaatgtacgatattttaataatgcgggggtataataATG

    CPE1159 Gene: CPE1159     GI: 18310141     BI number: CPE1159     GOG: COG4100     Description: conserved hypothetical protei CA G  A CG GT |  T |  T |  T |  T |  G TA AT A  A TA AT AT TA TA Ta At Ta |  t |  a       ag |  g      t  a |  a      c  t |  a       cg |  a       cg |  a       at |  g       at |  a       at |  a       tg Ta        gc Ta        gc Ta        at At        ta Ta        at Cg        at Cg        at At        at             ttttctatatgataagatttataaatgtacgatattttaataatgcgggggtataataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4100 Cystathionine beta-lyase family protein involved in aluminum resistance ... can be seen here     ..................................................................................................................