                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:61 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:39 nt. Size=46 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-tagaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaattctattaggttggggttgcatagaatatatgtaacactgtcacaaattattttgtggtgtgctatcatgaaagaagagtattgtatataacttt
acgaacccttaagcatgaaacacgcttaagggtttcttttgttagcgaaaacttagttatcacttatggcttaattattaaaaccataaggaggactaaa
aaaATG

    CPE1166 Gene: CPE1166     GI: 18310148     BI number: CPE1166     GOG: COG0833     Description: lysine specific permeas aa t  c a  t t  t at ta gc tg         a ta       a  a a  |       gc ta        ta gc       a  c a  c       cg gc        gc at        at at        at g  a       ta a  a       ta a  g       cg a  |       cg gc        cg ta        at at        at cg        gt             cttttgttagcgaaaacttagttatcacttatggcttaattattaaaaccataaggaggactaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0833 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................