                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:190 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:167 nt. Size=38 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:    Distance from promoter:126 nt.    Size=45 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-taaagt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgattttaattaaaagggaaagtggttaaagtccactacagcccccgctactgtgataggatacaagtttctatttgaccactgattatataaattggg
aagggagaaatgaggataagccttaagtcaggatacctgcctaaagatcatgaactaagcttcggagggaagagattagtacttatttgttcataatttt
gaggaataattactttgatttgtaagcatctgttctttgtagcacagatgctttttatttttaaattttagaggtgaaatATG

    cbiK --- cbiC --- cbiD --- cbiE --- cbiT --- cbiL Gene: cbiK     GI: 18310210     BI number: CPE1228     GOG: COG4822     Description: CbiK protein Gene: cbiC     GI: 18310209     BI number: CPE1227     GOG: COG2082     Description: precorrin isomerase Gene: cbiD     GI: 18310208     BI number: CPE1226     GOG: COG1903     Description: cobalamin biosynthesis protein Gene: cbiE     GI: 18310207     BI number: CPE1225     GOG: COG2241     Description: precorrin-6Y methylase Gene: cbiT     GI: 18310206     BI number: CPE1224     GOG: COG2242     Description: precorrin-8w decarboxylase Gene: cbiL     GI: 18310205     BI number: CPE1223     GOG: COG2243     Description: precorrin-2 methyltransferas ta g  c a  t t  t       ga ta       t  t at       t  t gt       t  t at        cg g  g       at at        ta        tg at        ta       t  t gc       |  g       ta |  a      |  c       cg |  t      |  a      t  c |  a      |  t       ta g  a      a  c       gc gt        at        ta at        tg        cg gt        at        ta gt        at        at cg        gc        cg ta        gt        gc tg        at        at cg        gt        at                         tttatttttaaattttagaggtgaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4822 Cobalamin biosynthesis protein CbiK, Co2+ chelatase ... can be seen here [H] COG2082 Precorrin isomerase ... can be seen here [H] COG1903 Cobalamin biosynthesis protein CbiD ... can be seen here [H] COG2241 Precorrin-6B methylase 1 ... can be seen here [H] COG2242 Precorrin-6B methylase 2 ... can be seen here [H] COG2243 Precorrin-2 methylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:193 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.20 kcal/mol Antiterminator:    Distance from promoter:157 nt. Size=38 nt.     Delta G= -5.70 kcal/mol Anti-antiterminator:    Distance from promoter:126 nt.    Size=45 nt.     Delta G= -9.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgatt-taaagt. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgattttaattaaaagggaaagtggttaaagtccactacagcccccgctactgtgataggatacaagtttctatttgaccactgattatataaattggg aagggagaaatgaggataagccttaagtcaggatacctgcctaaagatcatgaactaagcttcggagggaagagattagtacttatttgttcataatttt gaggaataattactttgatttgtaagcatctgttctttgtagcacagatgctttttatttttaaattttagaggtgaaatATG     cbiK --- cbiC --- cbiD --- cbiE --- cbiT --- cbiL Gene: cbiK     GI: 18310210     BI number: CPE1228     GOG: COG4822     Description: CbiK protein Gene: cbiC     GI: 18310209     BI number: CPE1227     GOG: COG2082     Description: precorrin isomerase Gene: cbiD     GI: 18310208     BI number: CPE1226     GOG: COG1903     Description: cobalamin biosynthesis protein Gene: cbiE     GI: 18310207     BI number: CPE1225     GOG: COG2241     Description: precorrin-6Y methylase Gene: cbiT     GI: 18310206     BI number: CPE1224     GOG: COG2242     Description: precorrin-8w decarboxylase Gene: cbiL     GI: 18310205     BI number: CPE1223     GOG: COG2243     Description: precorrin-2 methyltransferas ta g  c a  t t  t       ta ta       a  a at       a  t gt       g  t at        ga g  g       ac at        gt at        tt gc       |  t |  a      |  g       tg |  t      |  a      t  t |  a      |  t       ta g  a      t  t       cg gt        tt       t  c at        tg        ta gt        at        gc gt        aa        ta cg        ta        cg ta        ag        ta tg        cc        at cg        ta        cg                         ctttttatttttaaattttagaggtgaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4822 Cobalamin biosynthesis protein CbiK, Co2+ chelatase ... can be seen here [H] COG2082 Precorrin isomerase ... can be seen here [H] COG1903 Cobalamin biosynthesis protein CbiD ... can be seen here [H] COG2241 Precorrin-6B methylase 1 ... can be seen here [H] COG2242 Precorrin-6B methylase 2 ... can be seen here [H] COG2243 Precorrin-2 methylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................