                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:146 nt.    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tatcat. It has a score value of 85.01 and is shown in blue

ttgaaaaagaaaaggagctatggtatcatttggattagaaaatagcataaaaaatagctaggggggccagtagtgtctggctgagattagaaatgaaatt
tcttgaccctttaacctgatctggttaataccagcgtagggaagcccaagagacaaatatatttaaattgattttaaagcatatatagccttagggctgt
atatgctttttcttttttagaaggagtgaaaaatATG

    thiD --- thiM --- thiE Gene: thiD     GI: 18310320     BI number: CPE1338     GOG: COG0351     Description: phosphomethylpyrimidine kinase Gene: thiM     GI: 18310319     BI number: CPE1337     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: thiE     GI: 18310318     BI number: CPE1336     GOG: COG0352     Description: probable thiamine-phosphate pyrophosphorylas           ta          t  g           cg           cg           gc           at           tg           at           ta           at           ta           at           cg           gc           at           at           at             ttcttttttagaaggagtgaaaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:149 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaaa-tatcat. It has a score value of 85.01 and is shown in blue ttgaaaaagaaaaggagctatggtatcatttggattagaaaatagcataaaaaatagctaggggggccagtagtgtctggctgagattagaaatgaaatt tcttgaccctttaacctgatctggttaataccagcgtagggaagcccaagagacaaatatatttaaattgattttaaagcatatatagccttagggctgt atatgctttttcttttttagaaggagtgaaaaatATG     thiD --- thiM --- thiE Gene: thiD     GI: 18310320     BI number: CPE1338     GOG: COG0351     Description: phosphomethylpyrimidine kinase Gene: thiM     GI: 18310319     BI number: CPE1337     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: thiE     GI: 18310318     BI number: CPE1336     GOG: COG0352     Description: probable thiamine-phosphate pyrophosphorylas           ta          t  g           cg           cg           gc           at           tg           at           ta           at           ta           at           cg           gc             tttttcttttttagaaggagtgaaaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................