                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:124 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=41 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:    Distance from promoter:63 nt.    Size=45 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-taaaat. It has a score value of 84.34 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacctaattgcaatttgcatataaaatatacttagaattatttcatgtgctaggggtgcctttaggctgagagatgattattttatcattaaccctca
acacctgatctggaaaattccagcgtagggaagcgtttagggctgtatttaacaccggatctatatttagattcggtttttttatttacattctttagac
tctctaagcacacttaaagtttaaggagggggtaaaaactATG

    CPE1372 Gene: CPE1372     GI: 18310354     BI number: CPE1372     GOG: COG3859     Description: conserved hypothetical protei aa a  t at         t gc       t  a gc       t  g ta       g  g cg        cg t  c       gc a  g       at gt       |  g ta       a  t cg       g  a cg        gt        at a  g       gt       t  t c  a       at        at a  |       ta        ta a  |      |  a       cg c  |      g  c       ta ta       c  a       at cg       g  c       gt c  c      a  c       gc cg        cg        cg at        cg        cg at        ta        at                         ttttttatttacattctttagactctctaagcacacttaaagtttaaggagggggtaaaaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3859 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:124 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.60 kcal/mol Antiterminator:    Distance from promoter:88 nt. Size=41 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:    Distance from promoter:63 nt.    Size=45 nt.     Delta G=-10.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgacc-taaaat. It has a score value of 84.34 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacctaattgcaatttgcatataaaatatacttagaattatttcatgtgctaggggtgcctttaggctgagagatgattattttatcattaaccctca acacctgatctggaaaattccagcgtagggaagcgtttagggctgtatttaacaccggatctatatttagattcggtttttttatttacattctttagac tctctaagcacacttaaagtttaaggagggggtaaaaactATG     CPE1372 Gene: CPE1372     GI: 18310354     BI number: CPE1372     GOG: COG3859     Description: conserved hypothetical protei aa a  t at         t gc       t  t gc       g  a ta       c  g cg        gg t  c       ag a  g       ac gt       |  t ta       g  g cg       g  t cg        ga        at a  g       at       t  t c  a       tt        at a  |       gt        ta a  |      |  a       cg c  |      c  a       ta ta       g  c       at cg       a  a       gt c  c      c  c       gc cg        cc        cg at        tg        cg at        tg        at                         ttttttatttacattctttagactctctaagcacacttaaagtttaaggagggggtaaaaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3859 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................