                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:175 nt.    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAta-tatgat. It has a score value of 88.35 and is shown in blue

TTGAtaaaaaatgttttttgagttatgataaataaaacaaataattttaagatattgctaggggtgctgtaaaaggctgagagggataataagtcct
aactctaataacctgatttggttaataccagcgtagggaagtatattttaagttgtgatttttcatattagaaaatattattatgattaattagagaata
tatttttaaaaggtttagcaatattgctaaacctttttttgttggtataaaagtcttaagaatatagaaaagaggtgaagggATG

    CPE1603 Gene: CPE1603     GI: 18310585     BI number: CPE1603     GOG: COG2104     Description: conserved hypothetical protei           ta          a  t           at           cg           gc           at           ta           ta           ta           gc           gc           at           at           at           at             tttgttggtataaaagtcttaagaatatagaaaagaggtgaagggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................