                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:165 nt.    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-taaaat. It has a score value of 83.67 and is shown in blue

ttgaaatttatataaaaaagagttaaaattataacaaatgaaataaaaaaagtcttcagggcggggtgtgagtccccaccggcggtaaagcccgcgagct
agtttttagcatgattcggtgaaattccgaggccgacagtatagtctggatgaaagaagatgagtgtttaatgatttaaattctgaatttatatgccctg
atataagtatatgtatcagggcttttttatttgaaaaaaatcattaaagacttaatagccccagaggaagtaacttttgggaggggacaaaATG

    CPE2167 Gene: CPE2167     GI: 18311149     BI number: CPE2167     GOG: COG3601     Description: conserved hypothetical protei           ta          g  t          a  a           at           tg           at           ta           at           gc           ta           cg           cg           cg           gc             ttttttatttgaaaaaaatcattaaagacttaatagccccagaggaagtaacttttgggaggggacaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................