                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatggagttaagtagcgtagaagttttaggaaagggattatcgccgaagtttttggctaatactttaaggctaaatgctggggttgtatagaatatata
caacactgtcacaaaatgtggagagctatcatcttagggaattaaataaataaaagtttatttgcaaaagtaattttattaagtattaagaccttaggtt
gatcaagcctaaggtcttttttgcagaaattttataataagaaaaaataagggaatacctctgtaaattaattcactgcatatttaagggggaatttata
ATG

    CPE2527 Gene: CPE2527     GI: 18311509     BI number: CPE2527     GOG: COG1757     Description: conserved hypothetical protei ca g  a ta ta tg at ta ta t  | g  | at at at at ta at at |  a |  a a  g t  t a  a at at ta ta a  g        t a  a      a  c gc       g  a gc        ta gt        tg at        gc ta        gc tg        at cg        ta t  t       ta at        cg cg        cg ta        at at        gc             ttttttgcagaaattttataataagaaaaaataagggaatacctctgtaaattaattcactgcatatttaagggggaatttataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1757 Na+/H+ antiporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens This operon is putativelly rgulated by Lysine_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.10 kcal/mol Antiterminator: Size=76 nt.     Delta G=-14.70 kcal/mol Anti-antiterminator:   Size=59 nt.     Delta G= -5.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aaatggagttaagtagcgtagaagttttaggaaagggattatcgccgaagtttttggctaatactttaaggctaaatgctggggttgtatagaatatata caacactgtcacaaaatgtggagagctatcatcttagggaattaaataaataaaagtttatttgcaaaagtaattttattaagtattaagaccttaggtt gatcaagcctaaggtcttttttgcagaaattttataataagaaaaaataagggaatacctctgtaaattaattcactgcatatttaagggggaatttata ATG     CPE2527 Gene: CPE2527     GI: 18311509     BI number: CPE2527     GOG: COG1757     Description: conserved hypothetical protei            cc           a  t            gt            aa            ag            tg            tt            at ca       t  | g  a      g  | ta        ag ta        aa tg        tt at        tc ta        a ta        t t  |       t g  |      | at       | at       t at       t at       a ta        a at        t at        g |  a       a         t |  a      a        a  c a  g      a        g  a t  t       a        ta a  a       c        tg at        g        gc at        t        gc ta        t        at ta        t        ta a  g       a        ta a  a      t         cg g  |       t        cg gc        t        at gc        g        gc at        a        at                         tttttgcagaaattttataataagaaaaaataagggaatacctctgtaaattaattcactgcatatttaagggggaatttataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1757 Na+/H+ antiporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................