                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:71 nt.    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-17.00 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=68 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaacc-gataat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaacccttaaaacctgatctggataataccagcgtaggaaagcctgtagaaagttttataatagtattttatatgtttagattattatgactttttata
aattaagctacatcctacatggatgtagcttttattttttattagaaatgttataaccaactatgattataaactaaaaagtgtatgaaatttttagtta
gagttttataaaactttgaggtaattcttatttgggctattaggtttaatcataagattaaaggagatatagaatATG

    CPE2546 --- CPE2545 Gene: CPE2546     GI: 18311528     BI number: CPE2546     GOG: COG0819     Description: probable transcriptional regulator Gene: CPE2545     GI: 18311527     BI number: CPE2545     GOG: COG3859     Description: conserved hypothetical protei tg a  t t  t at ta tg ta t  t at ta gt at ta at a  | t  | a  | t  | t  | tg         c ta       a  a gc       t  t at        cg at        cg at        ta gt        at at        cg ta        at gt        ta ta        cg |  a       gc |  a       at |  t       at |  t      |  t |  a      t  t c  a       ta cg        at gc        at at        at             tttattagaaatgttataaccaactatgattataaactaaaaagtgtatgaaatttttagttagagttttataaaactttgaggtaattcttatttgggctattaggtttaatcataagattaaaggagatatagaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [S] COG3859 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:77 nt.    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.90 kcal/mol Antiterminator:    Distance from promoter:41 nt. Size=68 nt.     Delta G=-11.00 kcal/mol Anti-antiterminator:    Distance from promoter:17 nt.    Size=55 nt.     Delta G=-10.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttaacc-gataat. It has a score value of 61.58 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttaacccttaaaacctgatctggataataccagcgtaggaaagcctgtagaaagttttataatagtattttatatgtttagattattatgactttttata aattaagctacatcctacatggatgtagcttttattttttattagaaatgttataaccaactatgattataaactaaaaagtgtatgaaatttttagtta gagttttataaaactttgaggtaattcttatttgggctattaggtttaatcataagattaaaggagatatagaatATG     CPE2546 --- CPE2545 Gene: CPE2546     GI: 18311528     BI number: CPE2546     GOG: COG0819     Description: probable transcriptional regulator Gene: CPE2545     GI: 18311527     BI number: CPE2545     GOG: COG3859     Description: conserved hypothetical protei            tt           a  a           a  a            ag            tc            at            ta           t  c            ta tg        tt a  t       tc t  t       cc at        at ta        ga tg       t  | ta       a  | t  t      t  | at       t  | ta       a  | gt        tc at        ta ta        a at        g a  |       a t  |       t a  |       t t  |       t         c t  |       g       a  a tg        t       t  t ta        a        cg gc       |         cg at       |         ta at       |         at at       |         cg gt       |         at at       t         ta ta        a        cg gt        t        gc ta        t        at                         tttattttttattagaaatgttataaccaactatgattataaactaaaaagtgtatgaaatttttagttagagttttataaaactttgaggtaattcttatttgggctattaggtttaatcataagattaaaggagatatagaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [S] COG3859 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................