                                                                        Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -4.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCAGACAAATTTGAGGCAGCTTCATTACCAGGTTTATTTTCACAGGCACAAAGTTC
AAAGTTTTATTGTGGAGAGCAAAAGCATAGGGCTACAGCACGTGTTAAGGTAGGTACT
ACTCTTTATGAAGCTAAAGATATCAAAGATGCTAAATTAACTGCACATGCACAAACTA
AGTATTATAAAGGGGTAACAGAGTGGAATTCATATTACGCACATTTATAGtaatttaatgttt
aaaaggtatctttaaataataatttaaagatatcttttatattaatatgaaaaggagagtattTTG

    PCP08 --- PCP07 Gene: PCP08     GI: 15081488     BI number: PCP08     GOG: COG4652     Description: conserved hypothetical protein Gene: PCP07     GI: 15081487     BI number: PCP07     GOG: COG1136     Description: probable ABC transporte             T           A  T           C  T           A  A           C  T           G  A            CG            At            Ta            Ta CA        At A  T      T  t CG       A  t GC       C  a TA       T  a C  C      T  t A  A      A  g A  A       At T  A       Gt T  C       Gt A  T       Ta A  A      G  a A  |      A  a TA       G  a CG       A  g GT       C  g       at TA       A  |      a  a AT        At        ta GT        Ta        at |  A       Gt        at |  T       Gc        at |  A       Gt        ta |  A       Gt        ta A  A       At        ta A  G      A  a       cg A  G      A  a       ta CG        Ta        at TG        At        ta AT        Ta        gt TA        Ta        gc                         ttttatattaatatgaaaaggagagtattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4652 Uncharacterized protein conserved in bacteria ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here     ..................................................................................................................