                                                                        Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-11.70 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=33 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=73 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGaaa-aaaaat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGaaatcaataaagtggcgattaaaaatcgtcactttattttatatcaaaaacggttgtttttgatacgtttttttgaattatgaaaacaagccatt
ttttttgtataaaaatgtatcaaaaaaggtaccataatctattgagattatgatacctttttgatacaatattgttaagaaatttagaaagtggagatag
aaataattATG

    resP Gene: resP     GI: 15081495     BI number: PCP15     GOG: COG1961     Description: resolvas tt t  t tg ta ta gt c  | at ta at g  | tg ta ta ta ta gc |  a ta tg gc gc |  a |  t       aa |  t      a  a c  t       at        tt at        tg       a  g at        at        ta at        ta        cg at       |  t       ta at        gc        at cg        ta        at t  |       ta        ta at        ta        at ta        ta        cg at        ta       c  a ta        ta        at ta        tg        ta ta        tg        gc ta        at        gc                         tttttgatacaatattgttaagaaatttagaaagtggagatagaaataattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1961 Site-specific recombinases, DNA invertase Pin homologs ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens_pl-pCP13                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:129 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol Antiterminator: Size=72 nt.     Delta G=-16.87 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATATATAGAAACATCTTATGGTCAACCGACAGGAAGAGTAACATATGGAGTACAAAAA TCAATGTCTAATCATTATGTACAACCAACTTATCAGTAGaaatcaataaagtggcgattaaaaatcgtcac tttattttatatcaaaaacggttgtttttgatacgtttttttgaattatgaaaacaagccattttttttgtataaaaatgtatcaaaaaaggtaccataa tctattgagattatgatacctttttgatacaatattgttaagaaatttagaaagtggagatagaaataattATG     resP Gene: resP     GI: 15081495     BI number: PCP15     GOG: COG1961     Description: resolvas   a a  a ta ta at gc cg gt gc ta gc at at at ta at a  | c  | t  | a  | a  | at Gt At Ta Gt A  a C  t       gt T  c      g  t A  a       cg T  a       at T  a       at C  a       at A  a       at A  c       at Cg        cg Cg        ta At        at At        ta             cgtttttttgaattatgaaaacaagccattttttttgtataaaaatgtatcaaaaaaggtaccataatctattgagattatgatacctttttgatacaatattgttaagaaatttagaaagtggagatagaaataattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1961 Site-specific recombinases, DNA invertase Pin homologs ... can be seen here     ..................................................................................................................