Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:47 nt. Size=65 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatt-tatagt. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttattattgatttaattttccattatagtgctagttatttttactattataaagtttaataatttacattgtttaaactaattgctaaatagaatttta
actcatgttttaaaagttaaatatatattttaaatttaaggtgtcccacggggacatctttttgtttttaaaaggtaaatatgaataaaatttagataaa
agtgtaaaagaattatttttattttaaatttgttaaaattttgatataattgaattgtaaaaaaaatttcaggggggaatataaATG

    cpb2


Gene: cpb2     GI: 15081497     BI number: PCP17     GOG: -------     Description: beta2-toxi



  t
t  t
g  t
t  a
a  a
c  a
 ta
 cg
 at
 at
 ta
 ta
 ta
t  t
a  a
a  t
g  a
 at
 ta
 at
 at
 at
t  t
c  a        c
g  |      a  g
 ta        cg
 ta        cg
 at        cg
 at        ta
|  t       gc
|  a       ta
|  a       gt
 tg        gc
 cg        at
 at        at
            tttgtttttaaaaggtaaatatgaataaaatttagataaaagtgtaaaagaattatttttattttaaatttgttaaaattttgatataattgaattgtaaaaaaaatttcaggggggaatataaATG


    ..................................................................................................................