                                                                        Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=50 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:45 nt.    Size=48 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTG-TATATT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTGTTAAAGCAAATAAAAATTATATTAAGCTATTAAGTGATGAATTAAATCAAAA
AGAAGAAGATAACACAATGATCCTTGCAGTTGATATAAATAATAAAAGTATTATAGAA
GATTATAATTATGAAGTTTAAaagagtatttttaaaatactcttttatttttttaaaaagaactaaaggtgaaaaattattatag
gagtgaatatatATG

    PCP37 Gene: PCP37     GI: 15081517     BI number: PCP37     GOG: -------     Description: hypothetical protei            AT   A       A  T A  T       TA T  A       AT A  A       TG A  A       TA A  A      A  A TG       G  G AT       A  | TA        AT AT        GT GT        AT TA        TA         t T  T      |  A      t  a G  A      |  a       ta A  |      |  a       ta C  |      A  g       ta G  |       Ta        at TG        Tg        ta TA        At        gc C  A       Ta        at CG        Gt        gc TA        At        at AT        At        at GT        At        At TA        At        At AT        Ta        Ta                         tttttttaaaaagaactaaaggtgaaaaattattataggagtgaatatatATG     ..................................................................................................................