                                                                        Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-20.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-20.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTGCTGGAGGTATTGGTGGATTATTTTTCACTAAGAAGAGAAAATTATCATAAtaag
ataaaggtgtccccgggggacaccttttaaaatatgatttaaattacaaagtaattaaaagtgtccccgggggacacttttttttaggttatttgaaaag
gaagtgagattatagtgttagtaactatgattattttgatattatttttacttgattgtatttatatagaattatttaaaggagcaaagagagcagatat
tattatggcaaaattagcaaaggaagaattaagaaaataaaATG

    PCP56 Gene: PCP56     GI: 15081536     BI number: PCP56     GOG: COG3764     Description: conserved hypothetical protei            tt           a  a           a  c           a  a            ta            ta            tg   g        at c  g      g  a cg       t  a cg       a  | cg       t  | ta       a  | gc       a  | ta        at gc        at         g gc        ta       c  g at        ta        cg at        ta        cg at        ta        cg t  t      c  |       ta a  a       cg        gc g  a       at        ta a  a       cg        gc a  a       at        at t  |      g  |       at A  |       gc        at At        gc        at Ta        gc       t  t At        gc       t  t Cg        cg        at Ta        cg        at At        cg        ta                         ggttatttgaaaaggaagtgagattatagtgttagtaactatgattattttgatattatttttacttgattgtatttatatagaattatttaaaggagcaaagagagcagatattattatggcaaaattagcaaaggaagaattaagaaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens_pl-pCP13                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:157 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.20 kcal/mol Antiterminator: Size=60 nt.     Delta G=-20.40 kcal/mol Anti-antiterminator:   Size=25 nt.     Delta G=-16.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGTTGCTGGAGGTATTGGTGGATTATTTTTCACTAAGAAGAGAAAATTATCATAAtaag ataaaggtgtccccgggggacaccttttaaaatatgatttaaattacaaagtaattaaaagtgtccccgggggacacttttttttaggttatttgaaaag gaagtgagattatagtgttagtaactatgattattttgatattatttttacttgattgtatttatatagaattatttaaaggagcaaagagagcagatat tattatggcaaaattagcaaaggaagaattaagaaaataaaATG     PCP56 Gene: PCP56     GI: 15081536     BI number: PCP56     GOG: COG3764     Description: conserved hypothetical protei            at           a  t           t  a           g  a            aa            aa            ag            ct           a  g           t  t           t  |           a  |           a  |           a  |            tc            tc            tc            ac            gg            tg   g       a  | c  g       tg         g cg        a       c  g cg        a        cg cg        a        cg ta       a  |       cg gc        t        ta ta        t        gc gc        t        ta gc        t        gc at        c        at at        c        at at        a        at                         tttttaggttatttgaaaaggaagtgagattatagtgttagtaactatgattattttgatattatttttacttgattgtatttatatagaattatttaaaggagcaaagagagcagatattattatggcaaaattagcaaaggaagaattaagaaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here     ..................................................................................................................