                                                                        Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.40 kcal/mol
Antiterminator:    Distance from promoter:92 nt. Size=42 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:    Distance from promoter:77 nt.    Size=34 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-TTTTAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTAGAAAAGCCTTCTACAATTTTATTAGAACAAATTACTACTATATATAGACAT
CAGTTGAGTGAGAAGAAAGGAACTCTAACTAATAATGAAATAAAAAGATTGAATAGAG
CTTTAGTAATAAGCTTAGGTTTAATTTAGgatatttaagagtgttgcaattaggcagcactctttttaaatacaatttt
ttaggaaggagaagattaagtggattactttgatacatcctaaaattttttatcaaaaataaaaaaatgaaaacaaaaaaatggagggaaaaagGTG

    cna Gene: cna     GI: 15081537     BI number: PCP57     GOG: COG4932     Description: probable collagen adhesi            TT           T  A           A  G   T       A  g G  A      T  a A  A      T  t T  T       Ta TA        Gt TA        Gt CG        At        tt GC        Ta       a  a AT        Ta       a  g GT        Cg        cg |  A      G  a       gc A  G      A  g       ta TG        At        tg AT        Tg        gc AT        At        ta GT        At        gc TA        Tg        at TA        Gc        gc                         tttttaaatacaattttttaggaaggagaagattaagtggattactttgatacatcctaaaattttttatcaaaaataaaaaaatgaaaacaaaaaaatggagggaaaaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4932 Predicted outer membrane protein ... can be seen here     ..................................................................................................................