                                                                        Gene putatively regulated by attenuation in C_perfringens_pl-pCP13

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:188 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:121 nt. Size=71 nt.     Delta G=-17.12 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=75 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAC-AACAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAACTGCAAGTGAAATATTACAACAATTTAAAAATTCTCCTGCACATAATAAGAAT
ATTTTAGATGATGAGCTTACAGAAGGAGCTTGTGCAGTATATAAGAGTGCTGATGGTG
GATATTATTTTGCAATAGGATTTGATTATTAAatgtcattaaaattataaagtaattgaaagtgtccccgggggac
actttttaaaaaggttatatataaaaggcttagatttatctaagtcttttttaatatagtttttagggtggagattataTTG

    PCP58 Gene: PCP58     GI: 15081538     BI number: PCP58     GOG: COG2337     Description: conserved hypothetical protei TA T  A A  a T  t Tg         g At       c  g Gc        cg Ta        cg |  t       cg |  t       ta |  a       gc |  a       ta Ta        gc Ta        at At        at Gt        at G  a       gt A  t      |  t T  a      t  a A  a      t  a A  a      a  a Cg       a  a Gt       t  a Ta       g  g Ta       a  g |  t       at |  t       at T  g       ta T  a       at A  a       ta Ta       t  t       tt Tg       a  a      t  a At       a  t       at Tg       a  a       gc At       a  a       at Gc       t  a       ta Gc       t  a       ta T  |      a  |       cg Gc        cg        gt Gc        tg        gc Tg        gc        at                         tttttaatatagtttttagggtggagattataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2337 Growth inhibitor ... can be seen here     ..................................................................................................................