Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=58 nt.     Delta G=-19.33 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggtgattatagctagaaGGTAACACCCGTTCCCATGCCGAACACGATGGTTAAGCTTCTAAGCGC
CGATGGTACTGCAAGGGTGACCTTGTGGGAGAGTAGGACGttgccaggttagtatGATCCACTA
GCTCAGTCGGTAGAGCACATGACTTTTAATCATGGTGTCCGGGGTTCGATTCCCCGGT
GGATCACCAaaaaaactgtctacaattaatttgtggacagttttttattgcatttaaataatattaaagatttattaactatttttaagtaaat
tgacataaataacatagtaTTG

    CTC00064


Gene: CTC00064     GI: 28209838     BI number: CTC00064     GOG: -------     Description: hypothetical protei


            G
          C  A
          T  T
          T  T
           GC
  T        GC
T  T       GC
T  A       GC
C  A       CG
 AT        CG
 GC       |  T
 TA       |  G
 AT       |  G
 CG       |  A
A  |      T  T
 CG        GC
 GT        TA         a
A  G       GC       t  a
G  T       GC       t  t
A  |       TA        at
T  |      A  a       at
 GC       C  a       cg
 GC       T  a       at
 CG       A  a       tg
T  |      A  a       cg
G  |      T  a       ta
A  |      T  c       gc
 CG       T  t       ta
 TG       T  |       cg
 CG        Cg        at
 GT        At        at
 AT        Gc        at
                        tttattgcatttaaataatattaaagatttattaactatttttaagtaaattgacataaataacatagtaTTG


    ..................................................................................................................