Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:77 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.40 kcal/mol
Antiterminator:    Distance from promoter:63 nt. Size=29 nt.     Delta G= -5.01 kcal/mol
Anti-antiterminator:    Distance from promoter:23 nt.    Size=48 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgaat-gataat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaacgcg is shown in italic-bold style

gtgaatccaccttggagggattgtgataataaacagtacgttaagcacgttaagcttattttaaagaggattaattttacaagttaatcaattagggtgg
caacgcggagtctttcgtccctttaagggcacgaggggctttttttaatataaaaatataggagggtacatatATG

    CTC00081


Gene: CTC00081     GI: 28209854     BI number: CTC00081     GOG: COG0172     Description: seryl-tRNA synthetas


  a
t  c
 ta
 ta
 tg
 at
 at
 ta
 ta        tc         t
 at       g  t      t  a
 gc        at       t  a
g  a       gt        cg
a  a       gc        cg
g  |       cg        cg
a  |       gt       |  c
 at       c  |       ta
 at       a  |       gc
 ta       a  |       cg
 tg       c  |       ta
 tg       g  |       tg
 tg       g  |       tg
 at       t  |       cg
t  |       gc        tg
 tg        gc        gc
 cg        gc        at
 gc        at        gt
                        tttttaatataaaaatataggagggtacatatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0172 Seryl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................