                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:62 nt.    Distance to gene:28 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:21 nt. Size=53 nt.     Delta G= -4.92 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-taatat. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaaacttttccttctttattttaatatatatttaatatttataattattattgtaaaaaagatgcactacccatataattaaagtatgtattattatg
atatccttattataataattaattttcttaataaggaattttaaaaggggatgttgtaATG

    CTC00109 --- CTC00110 --- CTC00111 --- CTC00112 --- CTC00113 Gene: CTC00109     GI: 28209880     BI number: CTC00109     GOG: NOG09672     Description: conserved protein Gene: CTC00110     GI: 28209881     BI number: CTC00110     GOG: COG4241     Description: conserved protein Gene: CTC00111     GI: 28209882     BI number: CTC00111     GOG: COG3887     Description: MGPA protein Gene: CTC00112     GI: 28209883     BI number: CTC00112     GOG: COG0359     Description: LSU ribosomal protein L9P Gene: CTC00113     GI: 28209884     BI number: CTC00113     GOG: COG1067     Description: ATP-dependent protease L             a           t  a   a       a  t a  t      t  t t  a      a  a t  t      c  a t  t      c  a at        cg ta        at at        ta ta       c  | |  a       at |  t       cg at        gt ta        ta at        at        cc at        gt       t  t ta       a  a       at t  t      a  |       ta t  t      a  |       at tg       a  |       gt at        at        ta ta        at        at ta        ta        ta ta       g  t       ta c  a      t  g       at ta        ta        ta ta        at        ta cg        ta        at                         taattttcttaataaggaattttaaaaggggatgttgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4241 Predicted membrane protein ... can be seen here [T] COG3887 Predicted signaling protein consisting of a modified GGDEF domain and a DHH domain ... can be seen here [J] COG0359 Ribosomal protein L9 ... can be seen here [O] COG1067 Predicted ATP-dependent protease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.30 kcal/mol                                                                         Nomenclature/Definitions ggaaaaattcttccaagaagaatttcaggtaactgtgcaaaacatcaaagaaagcttactatagctattaaaaaagctagaaatatagctttactaccat atacaacagaataataaagttacataaagaaggaaaagtttattaaaacttttccttctttattttaatatatatttaatatttataattattattgtaa aaaagatgcactacccatataattaaagtatgtattattatgatatccttattataataattaattttcttaataaggaattttaaaaggggatgttgta ATG     CTC00109 --- CTC00110 --- CTC00111 --- CTC00112 --- CTC00113 Gene: CTC00109     GI: 28209880     BI number: CTC00109     GOG: NOG09672     Description: conserved protein Gene: CTC00110     GI: 28209881     BI number: CTC00110     GOG: COG4241     Description: conserved protein Gene: CTC00111     GI: 28209882     BI number: CTC00111     GOG: COG3887     Description: MGPA protein Gene: CTC00112     GI: 28209883     BI number: CTC00112     GOG: COG0359     Description: LSU ribosomal protein L9P Gene: CTC00113     GI: 28209884     BI number: CTC00113     GOG: COG1067     Description: ATP-dependent protease L           tt          a  a           ta           ta           ta           gc           at           at           at           at           gc           gc           at           at           gc           at           at             tattttaatatatatttaatatttataattattattgtaaaaaagatgcactacccatataattaaagtatgtattattatgatatccttattataataattaattttcttaataaggaattttaaaaggggatgttgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4241 Predicted membrane protein ... can be seen here [T] COG3887 Predicted signaling protein consisting of a modified GGDEF domain and a DHH domain ... can be seen here [J] COG0359 Ribosomal protein L9 ... can be seen here [O] COG1067 Predicted ATP-dependent protease ... can be seen here     ..................................................................................................................