                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:150 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=71 nt.     Delta G= -4.86 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=50 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATA-TATAGT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATATTGATATTAATGATTTTATAGTCTGTTCATCAAAGGATCATTATCAAACTCT
ATTTGAAGATTTTTTATATCTGGGAGTTAGTTTAGGTTTTACAGAAGAAGAAATAGAA
GATGCCTATTATGTAAAAAATAATACAAATCATCAAAGACAAGTTATAGGGTATTAAt
ctttaaaatgtagagttcaaactctacattttttattttatttaaataattatcgtcttgtATG

    CTC00140 Gene: CTC00140     GI: 28209911     BI number: CTC00140     GOG: COG3238     Description: conserved membrane protei            GA           A  C           A  A           A  A           C  G           T  T           A  T   A       C  A G  T      T  T A  G      A  A A  C      A  G GC       A  G AT        CG TA        AT AT        TA AT        AT A  A       AT G  |       TA A  |      A  A A  |      A  t G  |      A  c A  |       At A  |       At        ca G  |       At       t  a AT        Ta        ta CG       G  a       gc AT       T  a       at TA       A  a       gc TA       T  t       at TA        Tg        ta TA        At        gc G  A       Ta        ta G  A       Cg        at AT       |  a       at TA        Cg        at TA        Gt        at                         ttattttatttaaataattatcgtcttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3238 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:152 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.60 kcal/mol Antiterminator:    Distance from promoter:116 nt. Size=71 nt.     Delta G= -4.86 kcal/mol Anti-antiterminator:    Distance from promoter:88 nt.    Size=55 nt.     Delta G= -3.85 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTATA-TATAGT. It has a score value of 68.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTATATTGATATTAATGATTTTATAGTCTGTTCATCAAAGGATCATTATCAAACTCT ATTTGAAGATTTTTTATATCTGGGAGTTAGTTTAGGTTTTACAGAAGAAGAAATAGAA GATGCCTATTATGTAAAAAATAATACAAATCATCAAAGACAAGTTATAGGGTATTAAt ctttaaaatgtagagttcaaactctacattttttattttatttaaataattatcgtcttgtATG     CTC00140 Gene: CTC00140     GI: 28209911     BI number: CTC00140     GOG: COG3238     Description: conserved membrane protei   A A  A T  A G  A TA        aa AT       t  a TA       t  a TA       t  t AT       c  g |  A      t  t |  C      A  a |  A      A  g |  A      T  a |  A      T  g |  T      A  t |  C      T  t |  A       Gc |  T       Ga |  C       Ga |  A       A |  A       T |  A       A |  G      T |  A      T |  C      G |  A       A |  A       A |  G       C |  T       A        ca |  T      G        t  a |  A      A         ta |  T      A         gc |  A      A         at TG        C        gc CG        T        at CG        A        ta GT        C        gc TA       |         ta AT        T        at GT        A        at                         ttttattttatttaaataattatcgtcttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3238 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................