                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.10 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=32 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:    Distance from promoter:6 nt.    Size=33 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: cttata-tataat. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggtaccgcg is shown in italic-bold style

cttataactgatgcatgaatttatataattcatgcttatttgagtggtcatttagacaaattgggtggtaccgcgaagtcagtctttcgtccctttataa
ggatgaggggctttttattttaacttaatataaggaggattaacATG

    CTC00143 Gene: CTC00143     GI: 28209914     BI number: CTC00143     GOG: COG0017     Description: asparaginyl-tRNA synthetas   t t  t       ta        ta a  a      g  c      t  t cg        gc       t  a ta        tg       c  a gc        gc        cg g  a      g  g       cg t  a      g  a       ta g  a       ta        gt at        tg        cg gt        at        ta t  g      a  c       tg t  g      a  a       tg tg        cg        cg at        at        tg tg        gc        gc tg        at        at                         ttttattttaacttaatataaggaggattaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.20 kcal/mol Antiterminator: Size=47 nt.     Delta G= -7.20 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G= -9.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttatgaaatttaaagactatgataggaagagtagataaaggaggtatccaaagcgagccagtgacggtgcaagactggtgttacatctttattgaagaac atccttgagtttctaactgaaatctataagaaagtaggcttagaggtattcagtaccttataactgatgcatgaatttatataattcatgcttatttgag tggtcatttagacaaattgggtggtaccgcgaagtcagtctttcgtccctttataaggatgaggggctttttattttaacttaatataaggaggattaac ATG     CTC00143 Gene: CTC00143     GI: 28209914     BI number: CTC00143     GOG: COG0017     Description: asparaginyl-tRNA synthetas            tt           c  a           c  t           a  a            ta gt        gc a  a       at a  g       cg a  g      t  | gc        ta at        at at        tg ta        gc a  g      g  a        t ta       a  |      a  a cg       g  |      t  t tg        at        ta at        tg        ta |  a       ta        at at       c  a       at at        gt        gc gc        gt        ta ta        at        at cg        ta        cg at        gt        gc                         ttatttgagtggtcatttagacaaattgggtggtaccgcgaagtcagtctttcgtccctttataaggatgaggggctttttattttaacttaatataaggaggattaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................