                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:128 nt. Size=49 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGAAA-TATATT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAATACAAAATAACTCTATATATTTAATAGAACATAATGATAAGCGTCAAATAAG
ACAAATAAAAAACTTAGATAATAGCAAATTCTTACTTATAAGTAATTCAACAATGGTT
AATACAGAAGCGGTTGAAAAGAAACAAGTAAAAATTATAGCTAGATTGGACAAGGTTG
AGATAAATTTATAAtaaaaagtcatctagtaaatatttattagatgactttttattataaattctttgtaaaaatatgtactatgatgta
taatttaactatgtaaataaaATG

    CTC00174 Gene: CTC00174     GI: 28209944     BI number: CTC00174     GOG: COG0840     Description: methyl-accepting chemotaxis protei   A A  A T  T AT GT A  A GT TA TA Gt |  a |  a G  a A  a A  a       ta Cg       a  t At        at Gc        at G  |       ta T  |       gt Ta        at At        ta Gc        cg At        ta Ta        at Cg        cg Gt        ta             ctttttattataaattctttgtaaaaatatgtactatgatgtataatttaactatgtaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:165 nt.    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-15.00 kcal/mol Antiterminator:    Distance from promoter:133 nt. Size=49 nt.     Delta G= -7.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: GTGAAA-TATATT. It has a score value of 68.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTGAAATACAAAATAACTCTATATATTTAATAGAACATAATGATAAGCGTCAAATAAG ACAAATAAAAAACTTAGATAATAGCAAATTCTTACTTATAAGTAATTCAACAATGGTT AATACAGAAGCGGTTGAAAAGAAACAAGTAAAAATTATAGCTAGATTGGACAAGGTTG AGATAAATTTATAAtaaaaagtcatctagtaaatatttattagatgactttttattataaattctttgtaaaaatatgtactatgatgta taatttaactatgtaaataaaATG     CTC00174 Gene: CTC00174     GI: 28209944     BI number: CTC00174     GOG: COG0840     Description: methyl-accepting chemotaxis protei   A T  T T  A TA At A  a Aa Ta Aa Ga |  g |  t       ta A  c      a  t G  a       at T  t       at Tc        ta Gt        gt Ga        at A  |       ta A  |       cg Cg        ta At        at Ga        cg Ga        ta Ta        gc Tt        at Aa        at             tttattataaattctttgtaaaaatatgtactatgatgtataatttaactatgtaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................