                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=73 nt.     Delta G= -5.67 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTAGATGGTAAGAAACTATTTTTCAATGTTCAAGCTTGGGATGAAAAAGGAACGATA
GGAGAAGGAACACATGTAAGATATATAGTAAATAGTAAAAAGTTTATGGAAAAATTGA
AATAAggatataggctacaatataaagatatctgtactttttaatttacagatatctttttttaacttataatggtttgtgtaatataagaaatatg
aataattatataaaaatataacataatacaaaagtaaacaatgttatgtatttttgtaagtacatatcaaaggagtggtgaaggctaATG

    CTC00207 --- nifR --- CTC00209 --- greA --- CTC00211 Gene: CTC00207     GI: 28209974     BI number: CTC00207     GOG: COG1521     Description: putative transcriptional regulator Gene: nifR     GI: 28209975     BI number: CTC00208     GOG: COG0042     Description: nitrogen regulation protein nifR3 Gene: CTC00209     GI: 28209976     BI number: CTC00209     GOG: -------     Description: hypothetical protein Gene: greA     GI: 28209977     BI number: CTC00210     GOG: COG0782     Description: transcription elongation factor greA Gene: CTC00211     GI: 28209978     BI number: CTC00211     GOG: COG1190     Description: lysyl-tRNA synthetas GA T  A T  A A  T A  A A  A A  g A  g G  a Gt Ta At Ta Tg Tg Gc At A  | A  | A  | A  | Ta Gc        tt A  a      t  a Ta       t  a At       t  t A  a      c  t At        at Ta        ta G  a       gc A  a       ta T  g       cg A  |       ta Ta        at At        ta Ta        at At        gc Gc        at At        at             tttttaacttataatggtttgtgtaatataagaaatatgaataattatataaaaatataacataatacaaaagtaaacaatgttatgtatttttgtaagtacatatcaaaggagtggtgaaggctaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1521 Putative transcriptional regulator, homolog of Bvg accessory factor ... can be seen here [J] COG0042 tRNA-dihydrouridine synthase ... can be seen here [K] COG0782 Transcription elongation factor ... can be seen here [J] COG1190 Lysyl-tRNA synthetase (class II) ... can be seen here     ..................................................................................................................