                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggtaacgcg is shown in italic-bold style

gagtagtaaacctaaggtatttaaaagagagtgaggaaaggtgaaagctcacaatactaagagtttatgaatatggacctgaagcatagtatttgaaatt
agagtaaagtactacggtagcaaccgttaaattgcaaagtgattatatagtcacttatggaggtcttatttgtgaaaataagatatatttagagtggtaacgcgttttgagcaatacgcctctatacggaatatttcgtatagaggcttttttgtttatacaattaaattttagaaaattaattataggaggagtttaat
ATG

    CTC00243 Gene: CTC00243     GI: 28210009     BI number: CTC00243     GOG: COG0073,COG0143     Description: methionyl-tRNA synthetas            ag           g  c            ta tg        ta g  a      t  t ta        ta ta        gc ta        cg at        gc ta       c  c ta       a  t cg       a  c       ta ta       t  t      a  t gt       g  a       at |  a       gt        gt |  t       ta        gc g  a       gc        cg at       a  g       at gt       g  |       ta gt       a  |       at ta        tg        ta a  |       ta        cg tg        ta        ta ta        at        cg cg        ta        cg at        at        gc                         ttttttgtttatacaattaaattttagaaaattaattataggaggagtttaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0073 EMAP domain ... can be seen here [J] COG0143 Methionyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................