Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=77 nt.     Delta G= -5.09 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGAAAAATGAAATATTTAATATATGGTATACCAGGTACTAAGAAATTAAAGCATCAA
CCATTTAGAGGGAAAACAGGATTTGTAACTTGGGTTCCTTCAAAATCTAAAGAAGATA
ATGTTAATGGATATTGGCTAATGTTTTATGATTTCAAAAACTCTACTATATTAATTCC
TTCAAAAAAATAGgtgtgcattgcatacctattttttaatattatttaaccttctatcatatatttaagtattagaatttttaggaggtga
gtcccttttgaataagtcaatttaaaaggggttaaATG

    CTC00250


Gene: CTC00250     GI: 28210015     BI number: CTC00250     GOG: NOG15122     Description: conserved membrane-associated protei


           AC
          T  T
          C  A
          T  T
          C  A
          A  T
          A  T
          A  A
          A  A
          A  T
          C  T
          T  C
          T  C
          T  T
 AT        AT
A  G       GC
 TG        TA
 TA       A  A
 GT        TA
 TA        TA
 AT        TA
 AT        TA
 TG       G  A
A  G      T  |
 GC       A  |
 AT        AT
|  A       TA
|  A       CG
|  T      G  |
A  G      G  |        t
 GT       T  |      a  t
 AT        Tg        cg
 AT        At        gc
 AT        Tg        ta
 TA        At        gt
|  T      G  g       ta
 CG        Gc        gc
 TA        Ta        Gc
 AT        At        At
 AT        At        Ta
 AT        Tg        At
                        tttttaatattatttaaccttctatcatatatttaagtattagaatttttaggaggtgagtcccttttgaataagtcaatttaaaaggggttaaATG


    ..................................................................................................................