                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:146 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=43 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=36 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAA-tataat. It has a score value of 79.65 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAATAAttatggacatatactataattaacttgtataacttaataaatgtagtgctaggggtgctatataagagctgagaaatgaattatt
tatgatcaattcattaacccttgtacctgaactagataattctagcgtagggaagccttttatagatatagcctattatatagtattccttcaggaatgc
ttttttttatttatacccttcaagcacaaaataggaggtattattaaATG

    CTC00254 Gene: CTC00254     GI: 28210019     BI number: CTC00254     GOG: COG3859     Description: conserved membrane protei             t           a  a           t  g           a  c aa        gc t  t       at at        ta gc        at at       |  t ta       |  a cg       t  t a  c      t  a a  g      t  t gt        ta        tc ta        cg       t  a cg       c  t       cg cg       g  a       cg a  g       at        ta t  |       at        ta g  |       gc        at ta        gc        tg ta        gt        gc cg        at        at                         tttttttatttatacccttcaagcacaaaataggaggtattattaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3859 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................