                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:144 nt.    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:123 nt. Size=34 nt.     Delta G= -8.01 kcal/mol
Anti-antiterminator:    Distance from promoter:109 nt.    Size=28 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtag-tgaaat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtagagagtgaaagtttggtgaaatttcacaggtggaatcttaaggaaaatcgccttggagtagattgctgaaattttagtaagtatatccgtaatcc
tgcgttaaaggatagaacatgtttgtgtttgagaaagttacactatttttataggtggtatagcgaagatagacttcgtcctatttggacgaagtctttt
atattatgagaaaatagtttttatgtaaatttactgactattataataagtatATG

    CTC00261 Gene: CTC00261     GI: 28210025     BI number: CTC00261     GOG: COG0060     Description: isoleucyl-tRNA synthetas             a           t  g           a  a            gc            at            at            gc ta        cg t  t       gt         t ta       a  |      a  t tg       t  |      t  t tg       a  |       cg at       t  |       cg tg       g  |       ta cg       g  |       gc at       t  |       cg c  a       gc        ta at        gc        ta ta        at        cg tg        ta        at gc        at        gc                         ttttatattatgagaaaatagtttttatgtaaatttactgactattataataagtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................