                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=71 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACAATCCAGAAGTAGTTAGAGATATAATTAGCAAAATTGGAGCAAAACCTACAGATA
AGGGTGCAGAAATGATGTTATATGATGAAGAATTCAAAAAGACTTTAGATAAACTTTC
AAAGGAATTTAAACCTTATGCAGAAAAGGAGTGGGCTGAGGAATTTAACTCTACCGGA
AATTATTCTATGTCAAAGGGTTGAtttaaaaatatattaaaaagctgctaaaattatagcagctttttaatatattttgaca
atatgattttattaaactatgattaaaataattatattaaaataTTG

    CTC00267 Gene: CTC00267     GI: 28210030     BI number: CTC00267     GOG: COG1653     Description: extracellular solute-binding protei            TT           A  A            AT            AT            GC            GT           |  A           C  T            CG            AT           |  C           |  A           |  A            TA            CG            TG            CG            AT            AT            TG            TA           |  t           |  t           |  t           |  a       at           |  a      a  t           |  a      a  a           |  a       at           |  a       ta           |  t       cg TT       |  a       gc A  T      |  t       ta A  A       Ta        cg G  A       At        gc GC        At        at AT       G  a       at GC       G  a       at T  T      A  a       at C  A      G  a       at G  |       Ta        ta GC        Cg        ta GC        Gc        at TG        Gt        ta                         tattttgacaatatgattttattaaactatgattaaaataattatattaaaataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.30 kcal/mol Antiterminator: Size=71 nt.     Delta G= -7.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACAATCCAGAAGTAGTTAGAGATATAATTAGCAAAATTGGAGCAAAACCTACAGATA AGGGTGCAGAAATGATGTTATATGATGAAGAATTCAAAAAGACTTTAGATAAACTTTC AAAGGAATTTAAACCTTATGCAGAAAAGGAGTGGGCTGAGGAATTTAACTCTACCGGA AATTATTCTATGTCAAAGGGTTGAtttaaaaatatattaaaaagctgctaaaattatagcagctttttaatatattttgaca atatgattttattaaactatgattaaaataattatattaaaataTTG     CTC00267 Gene: CTC00267     GI: 28210030     BI number: CTC00267     GOG: COG1653     Description: extracellular solute-binding protei at a  a at aa at tt |  a t  a ta Aa |  a |  g |  c Gt Tg Tc Gt Ga Ga Aa Aa |  t | | | | | | | | | | A C        at T       a  t G        a  a T         at A         ta T         cg C        gc T        ta T        cg A        gc             tttttaatatattttgacaatatgattttattaaactatgattaaaataattatattaaaataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................