Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAGAAG. It has a score value of 63.59 and is shown in blue

TTGAAAATATAGTAAATATAAATGAATTAGAAGATCCAGATATTATAAAACCAGGTGA
CAAATTAATAATACCAGGTAGAGCAATTATTTAAtatagttaaggagtctgtagtttaaaaaactacagactttt
tgttattacccatgtataaatatgataaatatggtaaaaataaaggatatctgtaaaagagGTG

    CTC00281 --- CTC00282


Gene: CTC00281     GI: 28210044     BI number: CTC00281     GOG: COG4242     Description: cyanophycinase
Gene: CTC00282     GI: 28210045     BI number: CTC00282     GOG: COG0769,COG1181     Description: cyanophycin synthetas


           a
         a  a
          ta
          ta
          ta
          gc
          at
          ta
          gc
          ta
          cg
          ta
          gc
          at
          gt
            tttgttattacccatgtataaatatgataaatatggtaaaaataaaggatatctgtaaaagagGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[QP] COG4242 Cyanophycinase and related exopeptidases ... can be seen here
[M] COG0769 UDP-N-acetylmuramyl tripeptide synthase ... can be seen here
[M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here

    ..................................................................................................................