                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:177 nt.    Distance to gene:15 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-18.10 kcal/mol
Antiterminator:    Distance from promoter:119 nt. Size=74 nt.     Delta G= -4.17 kcal/mol
Anti-antiterminator:    Distance from promoter:93 nt.    Size=43 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: AGGAAC-TATTAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGAACTAGAAAAGAAAATTTATTATTATCAGAAAAAGAATATGAAGCATCATTTAAT
ATAAGAAGATTACTTTATGATGAAAATAATACTCAAAATGTTACAGAACAACTTATAA
ATATGCTTTGTAAAACTAAGAATAATGATGAATTTGTAGAAGTTATAAGTAAAATTGA
CTTAAGTAAGGAAAAAAATAGATAGgcgattaaatttaaatgagcggaataatctgctcatttaaattatattattttaaaa
ccatagggataaATG

    CTC00297 Gene: CTC00297     GI: 28210059     BI number: CTC00297     GOG: COG0840,COG3221     Description: methyl-accepting chemotaxis protei            AA           A  A           G  A           G  A           A  A           A  T           T  A           G  G           A  A            AT            TA            TG            Cg           A  |            Gc            Tg            Ta GA        At T  T       At A  G      A  a A  A      A  a TA        Ta        ta AT        Gt       a  a AT        At        at GT        At        gc A  G       Ta        gt AT       A  |       cg TA        Ta        gc CG        Ta        at |  A       Gt        gc A  A      A  g       ta A  G      A  a       at AT       G  |       at AT       A  |       at TA        Tg        ta GT        Gc        ta TA        Tg        ta TA        Tg        at TG        Ta        at                         atattattttaaaaccatagggataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here [P] COG3221 ABC-type phosphate/phosphonate transport system, periplasmic component ... can be seen here     ..................................................................................................................