                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:124 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:93 nt. Size=45 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAG-TATACT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAGAGTATGAAGAAAAAATATATACTCTAAATGAATATGTCGGCGTAAAAGGAGA
AATTTTAGACCCTTTCGGCGGCACGCTACCTATTTATCAACGAACCTTTGCACAATTA
AAAGAAAATATATTATTACTTTTAAGTAAATTAGAAGAAGATAAAAGTATTCATTAAg
gagtactcgtgtcttctttttttgtaaaaatcataaattatttggaggtgtagtattTTG

    CTC00307 --- CTC00308 Gene: CTC00307     GI: 28210068     BI number: CTC00307     GOG: COG0698     Description: ribose 5-phosphate isomerase Gene: CTC00308     GI: 28210069     BI number: CTC00308     GOG: COG0035     Description: uracil phosphoribosyltransferas   A T  A G  A AT AT TA TG        TA TA       T  A TA       A  g CG        Cg |  A       Ta A  A       Tg TG        At TA        Ta AT        Gc TA        At TA       A  c |  A      A  g A  A       At TG        Tg AT        At TA        Gc AT        At AT        At             ctttttttgtaaaaatcataaattatttggaggtgtagtattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0698 Ribose 5-phosphate isomerase RpiB ... can be seen here [F] COG0035 Uracil phosphoribosyltransferase ... can be seen here     ..................................................................................................................