                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -5.16 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -5.03 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATATAAGACTTGTATGTTTAGTAGCAGCTCCAGAAGGAATAAAAGTAGTAATGGAT
GCTCATCCAGATGTAGATATATATGTGGCTTCCATAGATGAAAAATTAGATGAATCAG
GATATATAGTTCCAGGATTAGGAGATGCAGGAGATAGATTATTTGGAACTAAGTAAta
ataaaaagtcggcatatgccgactttttatattacttagctataatttgtgactttaatttatgttatttttagtatagaataataaatagcatataaat
aaaatttaaagtgtacggaggattagATG

    CTC00309 --- CTC00310 --- CTC00311 Gene: CTC00309     GI: 28210070     BI number: CTC00309     GOG: COG2131     Description: come operon protein 2 Gene: CTC00310     GI: 28210071     BI number: CTC00310     GOG: COG0472     Description: putative undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase Gene: CTC00311     GI: 28210072     BI number: CTC00311     GOG: COG0381     Description: UDP-N-acetylglucosamine 2-epimeras            AA           G  C            GT   C        TA G  A       TA T  G       TG A  G       AT G  A       TA A  G       TA G  A       At G  T      |  a A  A      |  a TG       |  t TA       G  a AT       A  a GT       T  a |  A      A  a       ta |  T      G  a      a  t G  T      A  g       cg AT        Gt        gc CG        Gc        gc CG       A  g       cg TA        Cg        ta TA        Gc        gc GC        Ta        at                         ttttatattacttagctataatttgtgactttaatttatgttatttttagtatagaataataaatagcatataaataaaatttaaagtgtacggaggattagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG2131 Deoxycytidylate deaminase ... can be seen here [M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here [M] COG0381 UDP-N-acetylglucosamine 2-epimerase ... can be seen here     ..................................................................................................................