Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:176 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-14.80 kcal/mol
Antiterminator:    Distance from promoter:128 nt. Size=66 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:    Distance from promoter:116 nt.    Size=26 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAGT-TATAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAGTGAAATATAATTTCCCTATAATACAAAACTCTTGTCCAGCTAATGGATTTACT
AAAAGAGAATCTATAAAAAACTTAATAGAATCTCTTAAAAAAGATTTTCCTGATCTGG
AAAACCGATTGTTAGGAGCTTTAACAAATTCCAAGCAACTTTGTATTTGGGATAAATA
AatttggtaaacttagtataatattaacaatacctccttcatataaattattgaggaggtgttgttTTG

    CTC00319


Gene: CTC00319     GI: 28210079     BI number: CTC00319     GOG: NOG07113     Description: conserved protei


            a
          t  a
           at
           ta
           gt
           at
           ta
           ta
          c  c
          a  a
          a  a
           at
           ta
           gc
           gc
          t  |
          t  |
          t  |
          a  |
          A  |
          A  |
          T  |
          A  |        a
          A  |      a  a
          A  |      t  t
 CT       T  |       at
A  T       At        ta
 AT        Gc        at
 CG        Gc       c  t
 GT        Gt        tg
|  A      T  t       ta
|  T      T  c       cg
 AT        Ta        cg
 AT        At        ta
 CG        Ta        cg
 CG        Gt        cg
 TG        Ta        at
 TA        Ta        tg
 AT        Ta        at
                        tgttTTG


    ..................................................................................................................