                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:151 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:125 nt. Size=41 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:    Distance from promoter:98 nt.    Size=43 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatat. It has a score value of 84.34 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagctaaatagtaatatgctaatataaattagtaaaataattaaataaaaagctcttatcgagagaggtggagggaaagggccctatgaaacccgg
caaccaatatttttagaagtattaaggtgccaattcctgcagaaagttctgcaagataagagggctggcaaataaaaagcaagtctcttcttatcggaag
aggctttatttttatataagagctacacaataggaggtaaaaggATG

    CTC00321 Gene: CTC00321     GI: 28210081     BI number: CTC00321     GOG: COG0192     Description: S-adenosylmethionine synthetas ag a  t at gc at         a cg       t  a gc       a  a |  a      a  a |  a      a  a |  g       cg |  a       gc |  t      g  a |  a       ta |  a       cg        at |  g       gt       t  c ta        gc        tg cg        gt        cg cg       |  c       ta tg       |  t       ta t  c       at        cg a  |       gc        ta at        at        cg cg        at        tg cg        ta        gc gc        at        at ta        gc        at                         tatttttatataagagctacacaataggaggtaaaaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0192 S-adenosylmethionine synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................