                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:118 nt. Size=40 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaac-tataat. It has a score value of 79.65 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaacttttaattagaataatatataataatattgtaaaagataatattaaatatcttcagggcggggtgtaattccccaccggcggtatagcccgcga
gccgcaaggcatgattcggtgtaactccgaagccgacagtaaagtctggatgaaagaaggtataatagagataagtgtttttcgccctgacaaaaatttg
tcagggcttttattataccatcatcctaaaaattagaagataatattaggaggttgtattaaATG

    CTC00331 Gene: CTC00331     GI: 28210091     BI number: CTC00331     GOG: COG3601     Description: riboflavin transporte   a t  g a  a a  g ta at ta |  a g  g g  t       aa a  g      a  t at        at gt        at at        cg at        at at        gc gc        ta tg        cg a  c       cg gc        cg gc        gc             ttttattataccatcatcctaaaaattagaagataatattaggaggttgtattaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................