                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATGTATTTATACCACTATATCAAAAGGTTTTACACATACCAATTGAAGCTTTTATTC
AAATGGCATCAAAGGTAAATCCAGCAATAAATAGTTTAGGAACTTTAGTTTTATGGTC
AATAGTGCCCTTTAACTTATTAAAGGGAATATTTATATCTACACTTACTATGGGAATA
TATAAAAAAGTTTCCCCTATACTTCATGAAGATGGAGTAAAGAAAGGTCAAATAGCTT
AAattagtataaagtgaaatgaagcctggtttaggctttatttttttatacgatatttaatataggagGTG

    CTC00333 Gene: CTC00333     GI: 28210092     BI number: CTC00333     GOG: NOG41522     Description: conserved protei AA G  G TA AT         a CG       t  g TG       t  t TA       a  a CG       A  t AT       A  a TA        Ta A  A       Ta TA        Cg CG        Gt |  A      A  g |  A      T  a C  A      A  a        t CG       A  a      g  t CG        At        gt |  T       Cg        ta |  C      |  a       cg |  A      |  a       cg |  A       Tg        gc |  A       Gc        at T  T       Gc        at TA        At        gt TG       A  g       ta GC       A  g       at AT        Gt        at AT        At        at                         ttttatacgatatttaatataggagGTG     ..................................................................................................................