                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAAATACAAACAAAAAAATTAAAATTATAAAAAATAGAATTCACGGTAATTCATAAa
ataaaaaagtgtgtagcactttttttattttatgaataatgaacaatttaggtggattttcttccgctttgctgcagaaaatctttgattttttccaggg
cttgtttgcttcgctaaacatcgcgatttttataaaattaaaattttttcgtaatgataatggagaaaaaatatccacaattgttcattcttcattattc
cttgttcattaataaaaattttgttacgcaaaatttttattaATG

    CTC00350 Gene: CTC00350     GI: 28210107     BI number: CTC00350     GOG: COG3409,COG3773     Description: spore-cortex-lytic enzyme precurso   t g  a t  g gc ta gc |  t at at at at at at ta at at At At Ta At Cg Ta Ta At A  a Ta Gt |  g |  a                 tg |  a                t  c |  c                t  t |  a                 cg |  a                 gc |  t                c  | |  t                c  | |  t       tt       t  | |  a      t  c       ta G  g      t  t       cg Cg        at        ta At        gc        ta Cg        gc        ta Tg        tg        ta Ta        gc        at At        gt        gc At        at        gt                         ttgattttttccagggcttgtttgcttcgctaaacatcgcgatttttataaaattaaaattttttcgtaatgataatggagaaaaaatatccacaattgttcattcttcattattccttgttcattaataaaaattttgttacgcaaaatttttattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3409 Putative peptidoglycan-binding domain-containing protein ... can be seen here [M] COG3773 Cell wall hydrolyses involved in spore germination ... can be seen here     ..................................................................................................................