                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:193 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-13.80 kcal/mol
Antiterminator:    Distance from promoter:174 nt. Size=34 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:147 nt.    Size=33 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-taatat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaaaatacattgaaagaggaaagtaatatatatggaatttttagagagaaaatcccgtcggctgtaaggatttttaaaggaagtatatgtgaagtg
ccctctggagtattgcaccgaaatcagtaggctgcaacggttttacccgttatagtaataaagcattatagtgcttgaactttattctaagcctaattta
taggtagagtggaatacgaaagatacaacttcgtctctatttttgagatgaagttttttatttattccattataaggagggaaatttATG

    CTC00351 --- CTC00352 --- CTC00354 --- CTC00355 Gene: CTC00351     GI: 28210108     BI number: CTC00351     GOG: COG1045     Description: serine acetyltransferase Gene: CTC00352     GI: 28210109     BI number: CTC00352     GOG: COG1600     Description: iron-sulfur cluster-binding protein Gene: CTC00354     GI: 28210110     BI number: CTC00354     GOG: COG0204     Description: 1-acyl-sn-glycerol-3-phosphate acyltransferase Gene: CTC00355     GI: 28210111     BI number: CTC00355     GOG: COG0177     Description: endonuclease II   t         a t  t      t  c a  a      a  a at       g  a        t ta       a  c      t  t cg        at       a  t cg        at       t  t gt        gc        cg a  |       cg        ta a  |       at        cg ta       t  c       ta cg       a  |       gt ta        at        cg tg        gc        ta at        gt        ta tg        ta        cg tg        gt        at ta        at        at                         ttttatttattccattataaggagggaaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1045 Serine acetyltransferase ... can be seen here [C] COG1600 Uncharacterized Fe-S protein ... can be seen here [I] COG0204 1-acyl-sn-glycerol-3-phosphate acyltransferase ... can be seen here [L] COG0177 Predicted EndoIII-related endonuclease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:195 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.20 kcal/mol Antiterminator:    Distance from promoter:158 nt. Size=34 nt.     Delta G= -5.30 kcal/mol Anti-antiterminator:    Distance from promoter:152 nt.    Size=23 nt.     Delta G= -4.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaaa-taatat. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaaaaaatacattgaaagaggaaagtaatatatatggaatttttagagagaaaatcccgtcggctgtaaggatttttaaaggaagtatatgtgaagtg ccctctggagtattgcaccgaaatcagtaggctgcaacggttttacccgttatagtaataaagcattatagtgcttgaactttattctaagcctaattta taggtagagtggaatacgaaagatacaacttcgtctctatttttgagatgaagttttttatttattccattataaggagggaaatttATG     CTC00351 --- CTC00352 --- CTC00354 --- CTC00355 Gene: CTC00351     GI: 28210108     BI number: CTC00351     GOG: COG1045     Description: serine acetyltransferase Gene: CTC00352     GI: 28210109     BI number: CTC00352     GOG: COG1600     Description: iron-sulfur cluster-binding protein Gene: CTC00354     GI: 28210110     BI number: CTC00354     GOG: COG0204     Description: 1-acyl-sn-glycerol-3-phosphate acyltransferase Gene: CTC00355     GI: 28210111     BI number: CTC00355     GOG: COG0177     Description: endonuclease II             g           a  t           g  g           a  g           t  a   t        ga         t t  t       gt       t  t a  a       aa       a  t at        tc       t  t ta        ag        cg cg       t  a       ta cg       t  |       cg gt        ta        ta a  |       aa        gt a  |       ag        cg ta        ta        ta cg        ct        ta ta        ca        cg                         ttttttatttattccattataaggagggaaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1045 Serine acetyltransferase ... can be seen here [C] COG1600 Uncharacterized Fe-S protein ... can be seen here [I] COG0204 1-acyl-sn-glycerol-3-phosphate acyltransferase ... can be seen here [L] COG0177 Predicted EndoIII-related endonuclease ... can be seen here     ..................................................................................................................