                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:152 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.30 kcal/mol
Antiterminator:    Distance from promoter:121 nt. Size=44 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:    Distance from promoter:78 nt.    Size=66 nt.     Delta G= -8.54 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAA-TGGAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGAATAAAAGAAGATAGAGTTGGAATAGCACCAACAAAACATCCAGATCTTACTAA
GGAAGCAGATGAACTATCAGAAAAATACAAAGCAGCTATAAAAGCAGATAAATTTAAA
GTTCCAGGAACAAGAAAAGAACTTTTACAGTTTAAAGCTCCAGAAATTTAAatttaagagag
aaagctaggtgcttttgcatctagcttttttaatcaataggaaggaggcccaaaATG

    CTC00370 --- mglC --- rbsC Gene: CTC00370     GI: 28210126     BI number: CTC00370     GOG: COG3845     Description: sugar transport ATP-binding protein Gene: mglC     GI: 28210127     BI number: CTC00371     GOG: COG4603     Description: galactoside transport system permease protein mglC Gene: rbsC     GI: 28210128     BI number: CTC00372     GOG: COG1079     Description: ribose transport system permease protein rbs   T T  A T  C TA CG AT AT GT A  A A  A A  A A  G        a G  C      a  g A  |      t  a A  |       tg C  |       ta A  |      a  g AT       A  | GC       A  | GC        Ta A  A       Ta C  |       Ta CG       A  g TA       A  | TA       A  |       tt G  A       Gc       t  t AT        At        cg AT       |  a       gc AT        Cg        ta TA        Cg        gt TA       T  t       gc Ta        Cg        at At        Gc        ta At        At        cg At        At        gc Ta        At        at                         tttttaatcaataggaaggaggcccaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3845 ABC-type uncharacterized transport systems, ATPase components ... can be seen here [R] COG4603 ABC-type uncharacterized transport system, permease component ... can be seen here [R] COG1079 Uncharacterized ABC-type transport system, permease component ... can be seen here     ..................................................................................................................