                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=46 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGAAA-TGCAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAAACACAGTATTGTCTGATGCAATAATTATCAGTAACGGTAATATTCTAGATGA
AAAAATTACTAGATATCAAAATAGAGAAAATGTACAAACAGATATTGCATAAgtattacac
aatctctgtgcaacactttgtgcggagatttattttctttaaactaatataaggaggtttactATG

    CTC00374 --- CTC00373 Gene: CTC00374     GI: 28210130     BI number: CTC00374     GOG: COG1125     Description: glycine/betaine transport ATP-binding protein Gene: CTC00373     GI: 28210129     BI number: CTC00373     GOG: COG1174,COG1732     Description: glycine/betaine transport system permease protei   t g  a At At Ta A  c C  a Gc Ta Ta        ac At       c  t T  c       at At        at Gc        cg At       g  t Cg       t  g At        gc A  g       tg A  c       cg C  a       ta A  |       cg Ta        ta Gc        at Ta        at             tattttctttaaactaatataaggaggtttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1125 ABC-type proline/glycine betaine transport systems, ATPase components ... can be seen here [E] COG1174 ABC-type proline/glycine betaine transport systems, permease component ... can be seen here [M] COG1732 Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) ... can be seen here     ..................................................................................................................